Event ID![]() ![]() |
Disease: Acute Promyelocytic Leukemia ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: 15, 17 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q24.1 |
Exact position: Chr15: 74326416bp |
This breakpoint occurs in intron4 of NM_033238.2. |
Second Breakpoint![]() |
Location: q21.2 |
Exact position: Chr17: 38504195bp |
This breakpoint occurs in intron1 of NM_001024809.2. |
Junction Sequence(5'): GATATTCCTTACCCACAAATGCTATTGGTAATCGATGGGTTCCTTCCTAACTCGGGGGG |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: Southern blot, PCR, DNA sequencing |
Reference Information |
PubMed ID: 1848017 | ||||
Authors: Alcalay M,Zangrilli D,Pandolfi PP,Longo L,Mencarelli A,Giacomucci A,Rocchi M,Biondi A,Rambaldi A,Lo Coco F | ||||
Journal: Proceedings of the National Academy of Sciences of the United S |
Go to Genome Browser ( Click the image ) |
![]() |