Event ID![]() ![]() |
Patient Information: A 52-year-old man | ||||
Disease: Myxoid Liposarcoma ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: 12, 16 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q13.3 |
Exact position: Chr12: 57912909bp |
This breakpoint occurs in intron1 of NM_004083.4. |
Second Breakpoint![]() |
Location: p11.2 |
Exact position: Chr16: 31202431bp |
This breakpoint occurs in intron14 of NM_004960.2. |
Junction Sequence(5'): CTGCTGTATGGTGAATAGAGTTGCGAACAGAGGCCATAGGATAACAGGGTTTTGGCCCTGGCAAGATGGATTCCAGACCTTCTGCAGTCAGAAAGTTTCT |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: PCR, DNA sequencing |
Reference Information |
PubMed ID: 11162437 | ||||
Authors: Panagopoulos I,Mertens F,Isaksson M,Mandahl N | ||||
Journal: Biochemical and biophysical research communications |
Go to Genome Browser ( Click the image ) |
![]() |