Event ID![]() ![]() |
Disease: Undifferentiated Embryonal Sarcoma (UES) ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: 11, 19 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q11 |
Exact position: Chr11: 65270199bp |
This breakpoint occurs in NR_002819.2. |
Second Breakpoint![]() |
Location: q13.32 |
Exact position: Chr19: 47381610bp |
This breakpoint occurs in an intergenic region |
Junction Sequence(5'): GCTCCTCGGTGAATTGACAAGACTGTGCCATTGCACTCCAGTTGGGTGACATGCGCCACCGCACCCCAGCCTGGGTGACAGAGACCATATGTCACACCTCC |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: PCR, DNA sequencing |
Reference Information |
PubMed ID: 17311249 | ||||
Authors: Rajaram V,Knezevich S,Bove KE,Perry A,Pfeifer JD | ||||
Journal: Genes, chromosomes & cancer |
Go to Genome Browser ( Click the image ) |
![]() |