Event ID![]() ![]() |
Disease: Synovial Sarcoma ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: X, 18 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: p11.2 |
Exact position: ChrX: 52731095bp |
This breakpoint occurs in intron4 of NM_175698.1. |
Second Breakpoint![]() |
Location: q11.2 |
Exact position: Chr18: 23610913bp |
This breakpoint occurs in intron10 of NM_001007559.1. |
Junction Sequence(5'): TTTTAGATCATAGTTATCTTATATGGTCTTCTTAGACCTCACTTTAGCTATTGGCACATTTGCATTTGTCTATG |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: PCR, DNA sequencing |
Reference Information |
PubMed ID: 12687023 | ||||
Authors: Wei Y,Sun M,Nilsson G,Dwight T,Xie Y,Wang J,Hou Y,Larsson O,Larsson C,Zhu X | ||||
Journal: Oncogene |
Go to Genome Browser ( Click the image ) |
![]() |