About dbCRID

  • dbCRID (Database of Chromosomal Rearrangements In Diseases) is the largest database of curated database of human Chromosome rearrangements and associated diseases.
  • Current release: v 0.9 (06/30/2010).
  • Please direct questions and comments to dbCRID@biolead.org.

    • Related Databases

  • AtlasGeneticsOncology, Atlas of Genetics and Cytogenetics in Oncology and Haematology
  • ChimerDB 2.0, A knowledgebase for fusion genes updated
  • CytoD 1.0, A database of cytogenetic abnormalities.
  • DACRO, A disease-Associated Chromosomal Rearrangements Online.
  • Decipher, , A Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources
  • HYBRIDdb,A database of hybrid genes in the human genome.
  • Mitelman, A database of Chromosome Aberrations and Gene Fusions in Cancer.
  • SKY/M-FISH &CGH, A public platform for investigators to share and compare their molecular cytogenetic data.
  • TICdb, A database of Translocation breakpoints In Cancer.

    • References

  • Kong F, Zhu J, Wu J, Peng J, Wang Y, Wang Q, Fu S, Yuan L and Li T: dbCRID: a database of chromosomal rearrangements in human diseases. Nucleic Acids Res. [PubMed] [Full-text]
    • Event ID: 11340 ( Case ID: 12119 )
    Disease: Acute Myelocytic Leukemia ( DOID: 9119 ) All events related to this disease.
    Event Information
    Precision: A
    Chromosome Rearrangement Type: Reciprocal Translocation
    Chromosome: 7, 22
    Karyotype: t(7;22)(p12.2;q11.2)
    Breakpoints Information:
    First Breakpoint:
    Location: p12.2
    Exact position: Chr7: 46088304bp
    This breakpoint occurs in an intergenic region
    Second Breakpoint:
    Location: q11.2
    Exact position: Chr22: 22522680bp
    This breakpoint occurs in NC_000022.10.
    Junction Sequence(5'):
    AAGAACTGGATACAGAAACCCAAACACTTATTTTCATTACTTGATGCACAATGAAACTTCACCATCTCAGATTCTTGTCCATTCCACCTAGGAGCTTGGATTCATTCACTTGTTAGCTAACCATTAACTTCTTAGCACTAGGCACTAGGGTGCTAGACAGGAATGCCGAAGAA
    The Junction Sequence is Inferred.
    Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint.
    Experimental Method: FISH, PCR, DNA sequencing
    Reference Information
    PubMed ID: 14506701
    Authors: Hill AS,MacCallum PK,Young BD,Lillington DM
    Journal: Genes, chromosomes & cancer
    Go to Genome Browser ( Click the image )