Event ID![]() ![]() |
Symptom: Retarded psychomotor development,mild hypertelorism and bilateral epicanthal folds |
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: 2, 13 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: p16.1 |
Exact position: Chr2: 60149276bp |
This breakpoint occurs in an intergenic region |
Second Breakpoint![]() |
Location: q14.11 |
Exact position: Chr13: 41608410bp |
This breakpoint occurs in an intergenic region |
Junction Sequence(5'): ACATAGAGCTGGGAAAATCCTAATTTAGTGGAAAAGCTGGGAGATCCTGGAACAGAAAAAAATTGATCACAAGAT |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: DNA sequencing |
Reference Information |
PubMed ID: 19953122 | ||||
Authors: Chen W,Ullmann R,Langnick C,Menzel C,Wotschofsky Z,Hu H,Döring A,Hu Y,Kang H,Tzschach A,Hoeltzenbein M,Neitzel H,Markus S,Wiedersberg E,Kistner G,van Ravenswaaij-Arts CM,Kleefstra T,Kalscheuer VM,Ropers HH | ||||
Journal: European journal of human genetics : EJHG |
Go to Genome Browser ( Click the image ) |
![]() |