Event ID![]() ![]() |
Disease: Neurofibromatosis Type 1 ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Deletion![]() |
Chromosome: 17 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q11.2 |
Exact position: Chr17: 28284055bp |
This breakpoint occurs in intron3 of NM_001145053.1. |
Second Breakpoint![]() |
Location: q11.2 |
Exact position: Chr17: 30324251bp |
This breakpoint occurs in intron15 of NM_015355.2. |
Length of Deletion Segment is 2Mb. |
Junction Sequence : ATGGGCATCCTTATTTTGCTCCAGATTTTAGATGCAACCCTGGTGTCCGTAGGAAAGGGT |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: PCR, DNA sequencing |
Reference Information |
PubMed ID: 15776250 | ||||
Authors: Kehrer-Sawatzki H,Kluwe L,Fünsterer C,Mautner VF | ||||
Journal: Human genetics |
Go to Genome Browser ( Click the image ) |
![]() |