Event ID![]() ![]() |
Disease: Fabry Disease ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Deletion![]() |
Chromosome: X |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q22.1 |
Exact position: ChrX: 100653059bp |
This breakpoint occurs in exon 7 of NM_000169.2. |
Second Breakpoint![]() |
Location: q22.1 |
Exact position: ChrX: 100653071bp |
This breakpoint occurs in exon 7 of NM_000169.2. |
Length of Deletion Segment is 11bp. |
Junction Sequence : GGAGACAACTTTGAAGTCTCTCTCAGGCTTAGCC |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: RT-PCR, DNA sequencing |
Reference Information |
PubMed ID: 7504405 | ||||
Authors: Eng CM,Resnick-Silverman LA,Niehaus DJ,Astrin KH,Desnick RJ | ||||
Journal: American journal of human genetics |
Go to Genome Browser ( Click the image ) |
![]() |