Event ID![]() ![]() |
Symptom: A heart defect, hypotonia, and cryptorchidism |
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: 1, 9 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: p36.32 |
Exact position: Chr1: 4368482bp |
This breakpoint occurs in an intergenic region |
Second Breakpoint![]() |
Location: q34.2 |
Exact position: Chr9: 136550748bp |
This breakpoint occurs in intron 7 of NM_007101.3. |
Junction Sequence(5'): GCCTGTGGGCTTCAAGCACCTGGCCCGGGTGCTGGGGTCTGCCCCGATGACAGGGCAAGGGCATTCTA |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: FISH, CGH, DNA sequencing |
Reference Information |
PubMed ID: 16941016 | ||||
Authors: Gajecka M,Glotzbach CD,Jarmuz M,Ballif BC,Shaffer LG | ||||
Journal: European journal of human genetics : EJHG |
Go to Genome Browser ( Click the image ) |
![]() |