Event ID![]() ![]() |
Disease: Lung Cancer ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Deletion![]() |
Chromosome: 9 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: p21.3 |
Exact position: Chr9: 21970280bp |
This breakpoint occurs in intron1 of NM_058195.2. |
Second Breakpoint![]() |
Location: p21.3 |
Exact position: Chr9: 21975388bp |
This breakpoint occurs in intron1 of NM_058195.2. |
Length of Deletion Segment is 5Kb. |
Junction Sequence : TCTTGCACAAGTTTAAGAGGGAAAGGAAAAAGCAAAACTATTCTTTCCTAGT |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: PCR, DNA sequencing |
Reference Information |
PubMed ID: 12802286 | ||||
Authors: Sasaki S,Kitagawa Y,Sekido Y,Minna JD,Kuwano H,Yokota J,Kohno T | ||||
Journal: Oncogene |
Go to Genome Browser ( Click the image ) |
![]() |