Event ID![]() ![]() |
Disease: T-Cell Acute Myelocytic Leukemia-M5 ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: 11, 16 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q23.3 |
Exact position: Chr11: 118359131bp |
This breakpoint occurs in intron11 of NM_005933.2. |
Second Breakpoint![]() |
Location: p13.3 |
Exact position: Chr16: 3888903bp |
This breakpoint occurs in intron3 of NM_001079846.1. |
Junction Sequence(5'): TCTGTTAAATCTTGTATTATATTTATTTTGTTACTTTCTATTTCCACTGGTATATGAGACTGCTTTTCTAATGTTTTCCCGAAAACATTTTTTGCTGTGCCACATAAAATATTTCAGATAGCCACACAACATTTGAAGAGATAATTACCACTTTAGTACTCTGAATCTCCCGCAGTGTCCAATA |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: PCR, DNA sequencing |
Reference Information |
PubMed ID: 15334549 | ||||
Authors: Zhang Y,Zeleznik-Le N,Emmanuel N,Jayathilaka N,Chen J,Strissel P,Strick R,Li L,Neilly MB,Taki T,Hayashi Y,Kaneko Y,Schlegelberger B,Rowley JD | ||||
Journal: Genes, chromosomes & cancer |
Go to Genome Browser ( Click the image ) |
![]() |