Event ID![]() ![]() |
Symptom: Penoscrotal hypospadias, anal atresia with a recto-urethral fistula, a hypoplastic kidney |
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: 6, 17 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: p21.31 |
Exact position: Chr6: 35789988bp |
This breakpoint occurs in intron 3 of NM_182548.3. |
Second Breakpoint![]() |
Location: q11.2 |
Exact position: Chr17: 27620712bp |
This breakpoint occurs in exon 4 of NM_020772.2. |
Junction Sequence(5'): GATTATTGGTTCGGCTGGGGCAGGGTGTGTGTGTGGGGCTGGGGACCAAA |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: Southern blot, FISH, DNA sequencing |
Reference Information |
PubMed ID: 16395596 | ||||
Authors: Mansouri MR,Carlsson B,Davey E,Nordenskjöld A,Wester T,Annerén G,Läckgren G,Dahl N | ||||
Journal: Human genetics |
Go to Genome Browser ( Click the image ) |
![]() |