Event ID![]() ![]() |
Patient Information: A 2-year-old girl | ||||
Disease: Acute Myelocytic Leukemia-M7 ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: 11, 14 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q23.3 |
Exact position: Chr11: 118359130bp |
This breakpoint occurs in exon8 of NM_005933.2. |
Second Breakpoint![]() |
Location: q23.3 |
Exact position: Chr14: 67455211bp |
This breakpoint occurs in intron8 of NM_001024218.1. |
Junction Sequence(5'): TTATTTTGTTACTTTCTATTTCCACTGGTAGACACATTTGTTCTGAGTTAATAGACTTAACTTTTTATGCTAAATTTAATTAAGTACTTTAGTACTCTGAATCTCCC |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: Southern blot, PCR, FISH, DNA sequencing |
Reference Information |
PubMed ID: 11579461 | ||||
Authors: Eguchi M,Eguchi-Ishimae M,Seto M,Morishita K,Suzuki K,Ueda R,Ueda K,Kamada N,Greaves M | ||||
Journal: Genes, chromosomes & cancer |
Go to Genome Browser ( Click the image ) |
![]() |