Event ID![]() ![]() |
Disease: Neurofibromatosis Type 1 ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Deletion![]() |
Chromosome: 17 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q11.2 |
Exact position: Chr17: 29560750bp |
This breakpoint occurs in intron21 of NM_001042492.1. |
Second Breakpoint![]() |
Location: q12 |
Exact position: Chr17: 32270556bp |
This breakpoint occurs in intron1 of NM_001094.4. |
Length of Deletion Segment is 2.7Mb. |
Junction Sequence : AAAAATTTTCCTAAAATCACATCATTCTTAGAGGCTGCAGACCCTAGAAGGTTAACAGAC |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: FISH, PCR, DNA sequencing |
Reference Information |
PubMed ID: 18265407 | ||||
Authors: Kehrer-Sawatzki H,Schmid E,Fünsterer C,Kluwe L,Mautner VF | ||||
Journal: American journal of medical genetics. Part A |
Go to Genome Browser ( Click the image ) |
![]() |