Event ID![]() ![]() |
Disease: Hyperekplexia | ||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Deletion![]() |
Chromosome: 5 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q33.1 |
Exact position: Chr5: 151227700bp |
This breakpoint occurs in intron 1 of NM_001146040.1. |
Second Breakpoint![]() |
Location: q33.1 |
Exact position: Chr5: 151557346bp |
This breakpoint occurs in an intergenic region |
Length of Deletion Segment is 329646bp. |
Junction Sequence : TGCTTGCAAGGTTGCCTCTTGGAAACAGCCATGTGGGTGAGGG |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: DNA sequencing |
Reference Information |
PubMed ID: 16941485 | ||||
Authors: Becker K,Hohoff C,Schmitt B,Christen HJ,Neubauer BA,Sandrieser T,Becker CM | ||||
Journal: Human mutation |
Go to Genome Browser ( Click the image ) |
![]() |