Event ID![]() ![]() |
Disease: Neurofibromatosis Type 1 ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Deletion![]() |
Chromosome: 17 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q11.2 |
Exact position: Chr17: 28651627bp |
This breakpoint occurs in intron3 of NM_206832.1. |
Second Breakpoint![]() |
Location: q12 |
Exact position: Chr17: 31819849bp |
This breakpoint occurs in intron1 of NM_183377.1. |
Length of Deletion Segment is 3 Mb. |
Junction Sequence : AAGAAAGGATTCTTGCTCAAAAAAGAATGGGGGAAAGCTGCCCAGA |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: FISH, PCR, DNA sequencing |
Reference Information |
PubMed ID: 15103551 | ||||
Authors: Venturin M,Gervasini C,Orzan F,Bentivegna A,Corrado L,Colapietro P,Friso A,Tenconi R,Upadhyaya M,Larizza L,Riva P | ||||
Journal: Human genetics |
Go to Genome Browser ( Click the image ) |
![]() |