Event ID![]() ![]() |
Disease: Acute Myelocytic Leukemia ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: 8, 21 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q21.3 |
Exact position: Chr8: 93079698bp |
This breakpoint occurs in intron1 of NM_175635. |
Second Breakpoint![]() |
Location: q22.12 |
Exact position: Chr21: 36211213bp |
This breakpoint occurs in intron5 of NM_001754. |
Junction Sequence(5'): TATATAGTTTATATTATATAATTATTAACTTACTTTAACT |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: PCR, DNA sequencing |
Reference Information |
PubMed ID: 11753612 | ||||
Authors: Xiao Z,Greaves MF,Buffler P,Smith MT,Segal MR,Dicks BM,Wiencke JK,Wiemels JL | ||||
Journal: Leukemia : official journal of the Leukemia Society of America, |
Go to Genome Browser ( Click the image ) |
![]() |