Event ID![]() ![]() |
Disease: Acute Lymphoblastic Leukemia ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: 7, 11 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q21.2 |
Exact position: Chr7: 92364333bp |
This breakpoint occurs in intron2 of NM_001145306. |
Second Breakpoint![]() |
Location: q23.3 |
Exact position: Chr11: 118359697bp |
This breakpoint occurs in intron9 of NM_005933. |
Junction Sequence(5'): TTGATCTGTGGAATACTTCTCTTAGTATATGGTGGGCGGATCACTTGA |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: Southern blot, PCR, DNA sequencing |
Reference Information |
PubMed ID: 11930009 | ||||
Authors: Raffini LJ,Slater DJ,Rappaport EF,Lo Nigro L,Cheung NK,Biegel JA,Nowell PC,Lange BJ,Felix CA | ||||
Journal: Proceedings of the National Academy of Sciences of the United S |
Go to Genome Browser ( Click the image ) |
![]() |