Event ID![]() ![]() |
Patient Information: A 9-year 11-month-old girl | ||||
Disease: Acute Lymphoblastic Leukemia ( DOID![]() |
||||
Event Information |
Precision: A![]() |
||||
Chromosome Rearrangement Type: Reciprocal Translocation![]() |
Chromosome: 4, 11 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: q21.3 |
Exact position: Chr4: 87976144bp |
This breakpoint occurs in intron3 of NM_005935. |
Second Breakpoint![]() |
Location: q23.3 |
Exact position: Chr11: 118354694bp |
This breakpoint occurs in intron6 of NM_005933. |
Junction Sequence(5'): TTCTGGAACCTGGCCACTGTATTGC |
Junction Sequence(3'): ACTGTGACTGTGGCAATCTTTAGA |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: PCR, DNA sequencing |
Reference Information |
PubMed ID: 11493704 | ||||
Authors: Lovett BD,Lo Nigro L,Rappaport EF,Blair IA,Osheroff N,Zheng N,Megonigal MD,Williams WR,Nowell PC,Felix CA | ||||
Journal: Proceedings of the National Academy of Sciences of the United S |
Go to Genome Browser ( Click the image ) |
![]() |