Case ID![]() |
Disease: Lung Cancer ( DOID![]() |
||||
Reference Information |
PubMed ID: 12802286 | ||||
Authors: Sasaki S,Kitagawa Y,Sekido Y,Minna JD,Kuwano H,Yokota J,Kohno T | ||||
Journal: Oncogene |
Related Event(s): |
Event ID![]() |
Precision: A![]() |
Chromosome Rearrangement Type: Deletion![]() |
Chromosome: 9 |
Karyotype![]() |
Breakpoints Information: |
First Breakpoint![]() |
Location: p21.3 |
Exact position: Chr9: 21907151 |
This breakpoint occurs in an intergenic region |
Second Breakpoint![]() |
Location: p21.3 |
Exact position: Chr9: 22123317 |
This breakpoint occurs in an intergenic region |
Length of Deletion Segment is 216Kb. |
Junction Sequence : CTAAATATCCAAACTCTAGATGAAACTTTCCAATTTGGATGTCCTTTATT |
The Junction Sequence is Inferred![]() |
Note: Green and Blue color indicate 5' and 3' sequence according to the breakpoint. |
Experimental Method: PCR, DNA sequencing |